Transcript: Mouse XM_006495786.2

PREDICTED: Mus musculus phospholipase C, delta 4 (Plcd4), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plcd4 (18802)
Length:
2774
CDS:
58..2559

Additional Resources:

NCBI RefSeq record:
XM_006495786.2
NBCI Gene record:
Plcd4 (18802)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006495786.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076929 CCTCCCTATCTACCAGGATAT pLKO.1 912 CDS 100% 10.800 15.120 N Plcd4 n/a
2 TRCN0000076931 CATGTGGAGAACAATGGTATT pLKO.1 2209 CDS 100% 10.800 7.560 N Plcd4 n/a
3 TRCN0000076928 GCCAGCCAAAGGATCAATGAA pLKO.1 2637 3UTR 100% 5.625 3.938 N Plcd4 n/a
4 TRCN0000076930 CCATGTGGAGAACAATGGTAT pLKO.1 2208 CDS 100% 4.950 3.465 N Plcd4 n/a
5 TRCN0000076932 CTGTTGTTTATCATGGGCATA pLKO.1 1094 CDS 100% 4.050 2.835 N Plcd4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006495786.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.