Transcript: Mouse XM_006495948.2

PREDICTED: Mus musculus INO80 complex subunit D (Ino80d), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ino80d (227195)
Length:
3540
CDS:
457..3522

Additional Resources:

NCBI RefSeq record:
XM_006495948.2
NBCI Gene record:
Ino80d (227195)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006495948.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419609 ATAAGCCCTTGTGCTCATATA pLKO_005 497 CDS 100% 13.200 18.480 N INO80D n/a
2 TRCN0000426618 TGAATATGTGGCCAAGTATAA pLKO_005 609 CDS 100% 13.200 18.480 N INO80D n/a
3 TRCN0000251234 ATGAGTTGCCGGATGACATTG pLKO_005 2231 CDS 100% 10.800 15.120 N Ino80d n/a
4 TRCN0000251236 TCGAGTGCCTGAGTACAATTG pLKO_005 2435 CDS 100% 10.800 8.640 N Ino80d n/a
5 TRCN0000147250 GCACTTACTTTCAGCAGAAAT pLKO.1 1565 CDS 100% 13.200 9.240 N INO80D n/a
6 TRCN0000258158 GCGGACCTGTTTCCTCATTTA pLKO_005 1384 CDS 100% 13.200 9.240 N Ino80d n/a
7 TRCN0000436066 AGAGGAGATAACTCCCGTAAA pLKO_005 1996 CDS 100% 10.800 7.560 N INO80D n/a
8 TRCN0000251235 CAGATCAGGCTTCGCCATATC pLKO_005 1448 CDS 100% 10.800 6.480 N Ino80d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006495948.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.