Transcript: Mouse XM_006495981.2

PREDICTED: Mus musculus G protein-coupled receptor 1 (Gpr1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gpr1 (241070)
Length:
1926
CDS:
423..1484

Additional Resources:

NCBI RefSeq record:
XM_006495981.2
NBCI Gene record:
Gpr1 (241070)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006495981.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028203 CGTCCTAATAAGCAAGACGTT pLKO.1 1328 CDS 100% 2.640 3.696 N Gpr1 n/a
2 TRCN0000028170 CCTTTCAGATTAGGTTGCATT pLKO.1 1540 3UTR 100% 4.950 3.960 N Gpr1 n/a
3 TRCN0000435465 ATTCCTATGCCTTAGATTATT pLKO_005 466 CDS 100% 15.000 10.500 N Gpr1 n/a
4 TRCN0000422939 GATTTCTTCCCTGCAATTTAA pLKO_005 1620 3UTR 100% 15.000 10.500 N Gpr1 n/a
5 TRCN0000444177 GTGGCTCTGCAAGGTTAATTC pLKO_005 743 CDS 100% 13.200 9.240 N Gpr1 n/a
6 TRCN0000028175 GCCATCGCAGACTTCATCTTT pLKO.1 660 CDS 100% 5.625 3.938 N Gpr1 n/a
7 TRCN0000028136 GCTGCTTGAATCCCATCCTTT pLKO.1 1306 CDS 100% 4.950 3.465 N Gpr1 n/a
8 TRCN0000028150 CCTAGCATTTGTTCTGGGCAT pLKO.1 560 CDS 100% 2.160 1.512 N Gpr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006495981.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.