Transcript: Mouse XM_006495995.3

PREDICTED: Mus musculus coiled-coil domain containing 108 (Ccdc108), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cfap65 (241116)
Length:
5543
CDS:
467..5479

Additional Resources:

NCBI RefSeq record:
XM_006495995.3
NBCI Gene record:
Cfap65 (241116)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006495995.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250335 CGGCAACTGCACCCTCTATTA pLKO_005 2776 CDS 100% 13.200 18.480 N Cfap65 n/a
2 TRCN0000250334 GGGAACTTATGCGGCAGTATC pLKO_005 4308 CDS 100% 10.800 15.120 N Cfap65 n/a
3 TRCN0000250336 AGAAGCCTTCGCCGTTTATAA pLKO_005 1909 CDS 100% 15.000 10.500 N Cfap65 n/a
4 TRCN0000258020 CAGGATCTGAAGACCATAATA pLKO_005 5171 CDS 100% 15.000 10.500 N Cfap65 n/a
5 TRCN0000419125 GGCAACTGCACCCTCTATTAC pLKO_005 2777 CDS 100% 13.200 9.240 N CFAP65 n/a
6 TRCN0000250333 GACTTGATATGCAAGGTATAC pLKO_005 4283 CDS 100% 10.800 7.560 N Cfap65 n/a
7 TRCN0000152515 GAAGAGGAAGAGGAAGATGAT pLKO.1 5009 CDS 100% 4.950 2.475 Y NPM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006495995.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.