Transcript: Mouse XM_006496038.3

PREDICTED: Mus musculus neurobeachin like 1 (Nbeal1), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nbeal1 (269198)
Length:
7774
CDS:
431..6529

Additional Resources:

NCBI RefSeq record:
XM_006496038.3
NBCI Gene record:
Nbeal1 (269198)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496038.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143702 GATGATATGCCTCCAGGAATA pLKO.1 578 CDS 100% 10.800 8.640 N NBEAL1 n/a
2 TRCN0000249522 CAAGATGAAGCATGCTATATT pLKO_005 5324 CDS 100% 15.000 10.500 N Nbeal1 n/a
3 TRCN0000249523 CAGAGTATCATAGGTTATATA pLKO_005 3791 CDS 100% 15.000 10.500 N Nbeal1 n/a
4 TRCN0000262294 AGATCACCACAGGAGTTATTC pLKO_005 6473 CDS 100% 13.200 9.240 N NBEAL1 n/a
5 TRCN0000375469 CACATAGCATGGCCGGAATTT pLKO_005 2235 CDS 100% 13.200 9.240 N Nbeal1 n/a
6 TRCN0000375529 CTAATTGAGCAGGTATCATTA pLKO_005 3464 CDS 100% 13.200 9.240 N Nbeal1 n/a
7 TRCN0000144576 GAATATCTCTGCTTCCTGATA pLKO.1 594 CDS 100% 4.950 3.465 N NBEAL1 n/a
8 TRCN0000140350 CCTCCAGGAATATCTCTGCTT pLKO.1 587 CDS 100% 2.640 1.848 N NBEAL1 n/a
9 TRCN0000144418 CCTGATAATATTCTGCAGGTT pLKO.1 608 CDS 100% 2.640 1.848 N NBEAL1 n/a
10 TRCN0000140927 CCAGGAATATCTCTGCTTCCT pLKO.1 590 CDS 100% 0.264 0.158 N NBEAL1 n/a
11 TRCN0000145019 GAAAGATCCAGATTACCTGAA pLKO.1 481 CDS 100% 4.050 2.835 N NBEAL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496038.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.