Transcript: Mouse XM_006496170.1

PREDICTED: Mus musculus ring finger protein 25 (Rnf25), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rnf25 (57751)
Length:
2243
CDS:
896..2167

Additional Resources:

NCBI RefSeq record:
XM_006496170.1
NBCI Gene record:
Rnf25 (57751)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496170.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000297213 AGGTCCAAGATTCGCAGTTTG pLKO_005 957 CDS 100% 10.800 15.120 N Rnf25 n/a
2 TRCN0000179979 CCGATACTTCATTAGCCTTCA pLKO.1 1564 CDS 100% 4.050 5.670 N Rnf25 n/a
3 TRCN0000195977 CTGACCAATCAACTCTGCCAA pLKO.1 1683 CDS 100% 2.640 2.112 N Rnf25 n/a
4 TRCN0000297164 GATCACCATGGGAGATCTTTA pLKO_005 912 CDS 100% 13.200 9.240 N Rnf25 n/a
5 TRCN0000433686 TCCCTCTGAAGTTGAAGTATT pLKO_005 844 5UTR 100% 13.200 9.240 N RNF25 n/a
6 TRCN0000279361 ATGATCTTGCCTCGCTGAAAG pLKO_005 1407 CDS 100% 10.800 7.560 N Rnf25 n/a
7 TRCN0000217067 CCATGCTCTATGAACTCATTG pLKO.1 1128 CDS 100% 10.800 7.560 N Rnf25 n/a
8 TRCN0000179264 GAAGGAGATTCTCACGGATAA pLKO.1 1156 CDS 100% 10.800 7.560 N Rnf25 n/a
9 TRCN0000279296 GAAGGAGATTCTCACGGATAA pLKO_005 1156 CDS 100% 10.800 7.560 N Rnf25 n/a
10 TRCN0000184098 CTACTTCCCTAGCTGACCAAT pLKO.1 1671 CDS 100% 4.950 3.465 N Rnf25 n/a
11 TRCN0000297163 CTACTTCCCTAGCTGACCAAT pLKO_005 1671 CDS 100% 4.950 3.465 N Rnf25 n/a
12 TRCN0000179715 GCAGAACAATCTACTTCCCTA pLKO.1 1661 CDS 100% 2.640 1.584 N Rnf25 n/a
13 TRCN0000004602 TGGGAGGGAGGCAATAAAGAT pLKO.1 2197 3UTR 100% 5.625 3.375 N RNF25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496170.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.