Transcript: Mouse XM_006496272.2

PREDICTED: Mus musculus islet cell autoantigen 1-like (Ica1l), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ica1l (70375)
Length:
3679
CDS:
640..1623

Additional Resources:

NCBI RefSeq record:
XM_006496272.2
NBCI Gene record:
Ica1l (70375)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496272.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000442940 TTCGACTCAAGCTGGCGAAAT pLKO_005 621 5UTR 100% 10.800 15.120 N Ica1l n/a
2 TRCN0000175481 CAGACCTCAATAAGGTAGCTT pLKO.1 1184 CDS 100% 3.000 4.200 N Ica1l n/a
3 TRCN0000174956 GACACCTTCAAACAAATGGAA pLKO.1 853 CDS 100% 3.000 2.400 N Ica1l n/a
4 TRCN0000175266 CCTGAATATCTTAGCCTTAAT pLKO.1 2927 3UTR 100% 13.200 9.240 N Ica1l n/a
5 TRCN0000446822 GACACCTTGGTGACCATTAAC pLKO_005 757 CDS 100% 13.200 9.240 N Ica1l n/a
6 TRCN0000175884 GCCTTCTGATTGCTAAGCAAA pLKO.1 2454 3UTR 100% 4.950 3.465 N Ica1l n/a
7 TRCN0000175459 CAGATGATGACCCAAATCCAA pLKO.1 1045 CDS 100% 3.000 2.100 N Ica1l n/a
8 TRCN0000173390 GCTGCAATATGCTGTCTCACT pLKO.1 974 CDS 100% 2.640 1.848 N Ica1l n/a
9 TRCN0000174753 GCAGGTTGATTCAGATTGAAA pLKO.1 2701 3UTR 100% 5.625 3.375 N Ica1l n/a
10 TRCN0000194356 CAGCTCAGATGATGACCCAAA pLKO.1 1040 CDS 100% 4.050 2.430 N Ica1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496272.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.