Transcript: Mouse XM_006496756.3

PREDICTED: Mus musculus RAS protein activator like 2 (Rasal2), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rasal2 (226525)
Length:
10273
CDS:
1385..4729

Additional Resources:

NCBI RefSeq record:
XM_006496756.3
NBCI Gene record:
Rasal2 (226525)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496756.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238019 AGGACCTTCTATTCGGATTAA pLKO_005 2140 CDS 100% 13.200 18.480 N Rasal2 n/a
2 TRCN0000238018 TGACTAATCCTACGCCAATAC pLKO_005 3147 CDS 100% 10.800 15.120 N Rasal2 n/a
3 TRCN0000034346 CCATTCAAGTAGACCACTCAT pLKO.1 5645 3UTR 100% 4.950 6.930 N Rasal2 n/a
4 TRCN0000034347 CCATCTGACTAAATACCCTTT pLKO.1 5669 3UTR 100% 4.050 5.670 N Rasal2 n/a
5 TRCN0000374759 TCATAGCATCACGGTTCATAT pLKO_005 1972 CDS 100% 13.200 10.560 N Rasal2 n/a
6 TRCN0000238021 GATAACACAGACAGCTATTTC pLKO_005 3299 CDS 100% 13.200 9.240 N Rasal2 n/a
7 TRCN0000238020 GCTTCGAGGTCACCTACTTAA pLKO_005 1677 CDS 100% 13.200 9.240 N Rasal2 n/a
8 TRCN0000415097 ACATCAGTGAGCGGCTCATCA pLKO_005 2700 CDS 100% 4.950 3.465 N DAB2IP n/a
9 TRCN0000034345 CGTGTCTCTATCTACTGTCTT pLKO.1 5543 3UTR 100% 4.950 3.465 N Rasal2 n/a
10 TRCN0000034348 GCTCTTTAGAGCTGACAGATT pLKO.1 5513 3UTR 100% 4.950 3.465 N Rasal2 n/a
11 TRCN0000301609 GCTCTTTAGAGCTGACAGATT pLKO_005 5513 3UTR 100% 4.950 3.465 N Rasal2 n/a
12 TRCN0000034344 GCTGTCAGATATACAGAGATA pLKO.1 6228 3UTR 100% 4.950 3.465 N Rasal2 n/a
13 TRCN0000001405 GCCTTCCACCTCTTCATAGTA pLKO.1 1959 CDS 100% 5.625 3.938 N RASAL2 n/a
14 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7780 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496756.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.