Transcript: Mouse XM_006496770.3

PREDICTED: Mus musculus proline-rich coiled-coil 2C (Prrc2c), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prrc2c (226562)
Length:
10520
CDS:
295..8721

Additional Resources:

NCBI RefSeq record:
XM_006496770.3
NBCI Gene record:
Prrc2c (226562)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496770.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238739 CCTCGCCATGTTGATACAAAT pLKO_005 2869 CDS 100% 13.200 18.480 N Prrc2c n/a
2 TRCN0000238738 CAACCTCGACCTGGCTATTTC pLKO_005 2185 CDS 100% 13.200 10.560 N Prrc2c n/a
3 TRCN0000238736 TAAATTGTCTCCTCTAGTATT pLKO_005 9871 3UTR 100% 13.200 10.560 N Prrc2c n/a
4 TRCN0000238737 AGTACCTGATAACGATGAAAT pLKO_005 1608 CDS 100% 13.200 9.240 N Prrc2c n/a
5 TRCN0000238735 ATATGGATCCTCGAATGATAT pLKO_005 2450 CDS 100% 13.200 9.240 N Prrc2c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496770.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.