Transcript: Mouse XM_006496792.3

PREDICTED: Mus musculus activating transcription factor 6 (Atf6), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atf6 (226641)
Length:
7412
CDS:
362..2287

Additional Resources:

NCBI RefSeq record:
XM_006496792.3
NBCI Gene record:
Atf6 (226641)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496792.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374034 ATATGGCGACAGCTGTAATAG pLKO_005 679 CDS 100% 13.200 18.480 N Atf6 n/a
2 TRCN0000008447 CGAAGGGATCATCTGCTATTA pLKO.1 1988 CDS 100% 13.200 18.480 N Atf6 n/a
3 TRCN0000321328 AGAAGTATGGGTTCGGATATC pLKO_005 1169 CDS 100% 10.800 8.640 N Atf6 n/a
4 TRCN0000374112 GTCCAATGACAAAGCTTTAAT pLKO_005 1612 CDS 100% 15.000 10.500 N Atf6 n/a
5 TRCN0000011435 GCTCGGTAGTTTGTATCTTAA pLKO.1 4515 3UTR 100% 13.200 9.240 N Atf6 n/a
6 TRCN0000321327 GGCAAAGCAGCAGTCGATTAT pLKO_005 919 CDS 100% 13.200 9.240 N Atf6 n/a
7 TRCN0000008449 GCTGTCTGTGTGATGATAGTA pLKO.1 1409 CDS 100% 5.625 3.938 N Atf6 n/a
8 TRCN0000350564 GCTGTCTGTGTGATGATAGTA pLKO_005 1409 CDS 100% 5.625 3.938 N Atf6 n/a
9 TRCN0000008448 GCCATCATCATTCAGACACTA pLKO.1 881 CDS 100% 4.950 3.465 N Atf6 n/a
10 TRCN0000321326 GCCATCATCATTCAGACACTA pLKO_005 881 CDS 100% 4.950 3.465 N Atf6 n/a
11 TRCN0000008450 GCAGATTGACTGTCAGGTGAT pLKO.1 2116 CDS 100% 4.050 2.835 N Atf6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496792.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.