Transcript: Mouse XM_006496911.3

PREDICTED: Mus musculus cDNA sequence BC055324 (BC055324), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
BC055324 (381306)
Length:
3395
CDS:
90..3035

Additional Resources:

NCBI RefSeq record:
XM_006496911.3
NBCI Gene record:
BC055324 (381306)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496911.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246492 TCAAACACCACTCGGTTATAA pLKO_005 994 CDS 100% 15.000 21.000 N BC055324 n/a
2 TRCN0000246496 ATGTCCTGACTTCGGTGATTA pLKO_005 2356 CDS 100% 13.200 18.480 N BC055324 n/a
3 TRCN0000215483 GGATTGAACATATCCGAATTT pLKO.1 388 CDS 100% 13.200 18.480 N BC055324 n/a
4 TRCN0000246494 TGATAATGGTAGGAGTTATTC pLKO_005 886 CDS 100% 13.200 18.480 N BC055324 n/a
5 TRCN0000246495 TTGCATTTGTGGCAGTATATT pLKO_005 1986 CDS 100% 15.000 12.000 N BC055324 n/a
6 TRCN0000184696 CGGCTCCTCTCTATGTATCAA pLKO.1 354 CDS 100% 5.625 4.500 N BC055324 n/a
7 TRCN0000217109 CAAACACCACTCGGTTATAAA pLKO.1 995 CDS 100% 15.000 10.500 N BC055324 n/a
8 TRCN0000246493 ATGCTGACTACAGGTTATTTC pLKO_005 1129 CDS 100% 13.200 9.240 N BC055324 n/a
9 TRCN0000179457 GAGTACCTCTTTGTTAGCGAT pLKO.1 1757 CDS 100% 2.640 1.848 N BC055324 n/a
10 TRCN0000179484 GCTCTATTGAATGCTGTGCTT pLKO.1 1725 CDS 100% 2.640 1.848 N BC055324 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496911.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.