Transcript: Mouse XM_006497006.2

PREDICTED: Mus musculus DDB1 and CUL4 associated factor 6 (Dcaf6), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dcaf6 (74106)
Length:
2699
CDS:
113..2260

Additional Resources:

NCBI RefSeq record:
XM_006497006.2
NBCI Gene record:
Dcaf6 (74106)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497006.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239166 GTTGGCGTCACTGAATCATAT pLKO_005 2167 CDS 100% 13.200 18.480 N Dcaf6 n/a
2 TRCN0000239165 GGTTCCATCAAGTCCTAATTT pLKO_005 550 CDS 100% 15.000 10.500 N Dcaf6 n/a
3 TRCN0000239164 TGGAATGGTTGCTCGATTTAT pLKO_005 109 5UTR 100% 15.000 10.500 N Dcaf6 n/a
4 TRCN0000239163 TGAGATTTGTATACGACATTT pLKO_005 2290 3UTR 100% 13.200 9.240 N Dcaf6 n/a
5 TRCN0000129155 GAGCATTTGATGCTTCTGGAA pLKO.1 1931 CDS 100% 2.640 1.848 N DCAF6 n/a
6 TRCN0000344155 GAGCATTTGATGCTTCTGGAA pLKO_005 1931 CDS 100% 2.640 1.848 N DCAF6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497006.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.