Transcript: Mouse XM_006497128.3

PREDICTED: Mus musculus prospero homeobox 1 (Prox1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prox1 (19130)
Length:
7845
CDS:
447..2660

Additional Resources:

NCBI RefSeq record:
XM_006497128.3
NBCI Gene record:
Prox1 (19130)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497128.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070726 GCTAAGGCAAGGGCAACATTT pLKO.1 549 CDS 100% 13.200 18.480 N Prox1 n/a
2 TRCN0000070724 CCGAAGTACATCAGGAGGATA pLKO.1 808 CDS 100% 4.950 6.930 N Prox1 n/a
3 TRCN0000070725 CGGACGTGAAGTTCAACAGAT pLKO.1 2269 CDS 100% 4.950 6.930 N Prox1 n/a
4 TRCN0000420735 TTTGCCCAAGGCCCTTAATAT pLKO_005 2868 3UTR 100% 15.000 12.000 N Prox1 n/a
5 TRCN0000232123 AGTACATCAGGAGGATATATG pLKO_005 812 CDS 100% 13.200 9.240 N PROX1 n/a
6 TRCN0000432522 AGTTTGATGTGGATCGCTTAT pLKO_005 898 CDS 100% 10.800 7.560 N Prox1 n/a
7 TRCN0000016249 CCCGAGAAAGTTACAGAGAAA pLKO.1 1045 CDS 100% 4.950 3.465 N PROX1 n/a
8 TRCN0000070723 CGGGCAAAGATGTTGATCCTT pLKO.1 2539 CDS 100% 3.000 2.100 N Prox1 n/a
9 TRCN0000070727 CACCTTATTCAGGAAGCGCAA pLKO.1 2152 CDS 100% 2.160 1.512 N Prox1 n/a
10 TRCN0000425447 GCATCTGGCAGAGACCTTAAA pLKO_005 1484 CDS 100% 13.200 7.920 N Prox1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497128.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.