Transcript: Mouse XM_006497435.1

PREDICTED: Mus musculus inter-alpha (globulin) inhibitor H5 (Itih5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Itih5 (209378)
Length:
7833
CDS:
131..2887

Additional Resources:

NCBI RefSeq record:
XM_006497435.1
NBCI Gene record:
Itih5 (209378)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497435.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092300 CGGTGAAGTCTACCATCATTT pLKO.1 294 CDS 100% 13.200 18.480 N Itih5 n/a
2 TRCN0000327388 CGGTGAAGTCTACCATCATTT pLKO_005 294 CDS 100% 13.200 18.480 N Itih5 n/a
3 TRCN0000092302 GAATGGGATCTTGGGAGATTT pLKO.1 781 CDS 100% 13.200 9.240 N Itih5 n/a
4 TRCN0000327386 GAATGGGATCTTGGGAGATTT pLKO_005 781 CDS 100% 13.200 9.240 N Itih5 n/a
5 TRCN0000092299 CCTGAGGAATACGGCAAGAAT pLKO.1 2594 CDS 100% 5.625 3.938 N Itih5 n/a
6 TRCN0000327467 CCTGAGGAATACGGCAAGAAT pLKO_005 2594 CDS 100% 5.625 3.938 N Itih5 n/a
7 TRCN0000092298 TCTACTCTGGACGCAACTCTT pLKO.1 2906 3UTR 100% 4.950 3.465 N Itih5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497435.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.