Transcript: Mouse XM_006497499.3

PREDICTED: Mus musculus Scm-like with four mbt domains 2 (Sfmbt2), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sfmbt2 (353282)
Length:
11363
CDS:
4957..7170

Additional Resources:

NCBI RefSeq record:
XM_006497499.3
NBCI Gene record:
Sfmbt2 (353282)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497499.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329354 CGGATGTGGTACGATTCATTA pLKO_005 6965 CDS 100% 13.200 18.480 N Sfmbt2 n/a
2 TRCN0000329285 TTCGTCAACCACCGGTGTTTC pLKO_005 5836 CDS 100% 10.800 15.120 N Sfmbt2 n/a
3 TRCN0000329357 CCTATTTGATAGTCCTATATT pLKO_005 7327 3UTR 100% 15.000 12.000 N Sfmbt2 n/a
4 TRCN0000329356 CCCTCTGACCACACCATATAA pLKO_005 5652 CDS 100% 15.000 10.500 N Sfmbt2 n/a
5 TRCN0000329288 TGGGACCCGCTATCAAGTTAT pLKO_005 7097 CDS 100% 13.200 9.240 N Sfmbt2 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 867 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497499.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.