Transcript: Mouse XM_006497568.3

PREDICTED: Mus musculus USP6 N-terminal like (Usp6nl), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Usp6nl (98910)
Length:
9259
CDS:
195..2705

Additional Resources:

NCBI RefSeq record:
XM_006497568.3
NBCI Gene record:
Usp6nl (98910)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497568.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086811 CGAGAAGTTTCATCGACGAAT pLKO.1 515 CDS 100% 4.950 6.930 N Usp6nl n/a
2 TRCN0000086809 CGACGAATTTACAAAGGAATT pLKO.1 528 CDS 100% 0.000 0.000 N Usp6nl n/a
3 TRCN0000086812 CGAGCTGAAATAGTTGCTAAA pLKO.1 288 CDS 100% 10.800 8.640 N Usp6nl n/a
4 TRCN0000086808 CCTCTTCTTGTATCTGAATAT pLKO.1 3878 3UTR 100% 13.200 9.240 N Usp6nl n/a
5 TRCN0000086810 CCTCTCTTTCAGTTGACACTT pLKO.1 2230 CDS 100% 4.950 3.465 N Usp6nl n/a
6 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 5366 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497568.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.