Transcript: Mouse XM_006497668.2

PREDICTED: Mus musculus lipocalin 5 (Lcn5), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lcn5 (13863)
Length:
1448
CDS:
49..621

Additional Resources:

NCBI RefSeq record:
XM_006497668.2
NBCI Gene record:
Lcn5 (13863)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497668.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000445047 GGTGAAGGACTTCGACGTAAA pLKO_005 141 CDS 100% 10.800 15.120 N Lcn5 n/a
2 TRCN0000416782 AGCCGGAGCTTGGACAACAAT pLKO_005 487 CDS 100% 5.625 7.875 N Lcn5 n/a
3 TRCN0000106385 GCCACAGACTACATGACGTAT pLKO.1 406 CDS 100% 4.950 6.930 N Lcn5 n/a
4 TRCN0000106389 CCTATTACAATGAGGGCCACT pLKO.1 293 CDS 100% 2.160 3.024 N Lcn5 n/a
5 TRCN0000422232 CAGAAACAGACATACACATTC pLKO_005 557 CDS 100% 10.800 7.560 N Lcn5 n/a
6 TRCN0000106386 GCAGTACATCGAGCCATGAAA pLKO.1 460 CDS 100% 5.625 3.938 N Lcn5 n/a
7 TRCN0000106387 GTTGAGCTGAAAGAGAACCTT pLKO.1 256 CDS 100% 3.000 2.100 N Lcn5 n/a
8 TRCN0000106388 GATAGCCTTGAAGCATGGGTT pLKO.1 534 CDS 100% 2.640 1.848 N Lcn5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497668.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.