Transcript: Mouse XM_006497693.1

PREDICTED: Mus musculus formin binding protein 1 (Fnbp1), transcript variant X13, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fnbp1 (14269)
Length:
5263
CDS:
201..1868

Additional Resources:

NCBI RefSeq record:
XM_006497693.1
NBCI Gene record:
Fnbp1 (14269)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497693.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338106 CTGGTCGTAGAAGCCTATAAG pLKO_005 999 CDS 100% 13.200 18.480 N Fnbp1 n/a
2 TRCN0000338104 AGAGGCGGATTGTGCGTATTG pLKO_005 862 CDS 100% 10.800 8.640 N Fnbp1 n/a
3 TRCN0000338036 TCAAGGAGAGGACGGAGATTG pLKO_005 295 CDS 100% 10.800 7.560 N Fnbp1 n/a
4 TRCN0000184131 CCAGGAGCAATGGGAATACTA pLKO.1 794 CDS 100% 5.625 3.938 N Fnbp1 n/a
5 TRCN0000184445 GCCTTTCTTTCCACCCTGAAT pLKO.1 414 CDS 100% 4.950 3.465 N Fnbp1 n/a
6 TRCN0000338034 GCCTTTCTTTCCACCCTGAAT pLKO_005 414 CDS 100% 4.950 3.465 N Fnbp1 n/a
7 TRCN0000179098 CCAACCTAAGAAGAACTCGAA pLKO.1 359 CDS 100% 2.640 1.848 N Fnbp1 n/a
8 TRCN0000201485 CCTCTTGAGTGCTGGGATTAA pLKO.1 3856 3UTR 100% 13.200 6.600 Y D830050J10Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497693.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.