Transcript: Mouse XM_006497733.1

PREDICTED: Mus musculus LIM homeobox protein 2 (Lhx2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lhx2 (16870)
Length:
2861
CDS:
1011..2255

Additional Resources:

NCBI RefSeq record:
XM_006497733.1
NBCI Gene record:
Lhx2 (16870)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497733.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000225892 CGAATACCCAGCACACTTTAA pLKO_005 1559 CDS 100% 13.200 18.480 N Lhx2 n/a
2 TRCN0000070533 CGTGCCTTAGGAATACTGTTT pLKO.1 2567 3UTR 100% 4.950 6.930 N Lhx2 n/a
3 TRCN0000225894 GGAATTACTTGGGAGATATAT pLKO_005 2442 3UTR 100% 15.000 10.500 N Lhx2 n/a
4 TRCN0000225893 GGACAATGAAGTCTTACTTTG pLKO_005 1870 CDS 100% 10.800 7.560 N Lhx2 n/a
5 TRCN0000257259 TTCACATGCACAACGTGTAAC pLKO_005 1455 CDS 100% 10.800 7.560 N Lhx2 n/a
6 TRCN0000070536 CTTCACATGCACAACGTGTAA pLKO.1 1454 CDS 100% 4.950 3.465 N Lhx2 n/a
7 TRCN0000218692 TACTGCAAAGAAGACTACTAC pLKO_005 1311 CDS 100% 4.950 3.465 N Lhx2 n/a
8 TRCN0000070537 CTTAGCTGTAACGAGAACGAT pLKO.1 1764 CDS 100% 3.000 2.100 N Lhx2 n/a
9 TRCN0000070535 GCCATTAACCACAATCCCGAT pLKO.1 1890 CDS 100% 2.160 1.512 N Lhx2 n/a
10 TRCN0000070534 GCCCTTCACAAACGACTCTTA pLKO.1 2221 CDS 100% 4.950 2.970 N Lhx2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497733.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.