Transcript: Mouse XM_006497988.2

PREDICTED: Mus musculus Rab9 effector protein with kelch motifs (Rabepk), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rabepk (227746)
Length:
2312
CDS:
203..967

Additional Resources:

NCBI RefSeq record:
XM_006497988.2
NBCI Gene record:
Rabepk (227746)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497988.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176638 CCTAGTGCAAATAATTCCATT pLKO.1 1254 3UTR 100% 4.950 6.930 N Rabepk n/a
2 TRCN0000177723 CGGAAACCAACTATACGTCTT pLKO.1 292 CDS 100% 4.050 3.240 N Rabepk n/a
3 TRCN0000350186 CGGAAACCAACTATACGTCTT pLKO_005 292 CDS 100% 4.050 3.240 N Rabepk n/a
4 TRCN0000197878 GATGTCTACCTCTGAGAATAA pLKO.1 763 CDS 100% 13.200 9.240 N Rabepk n/a
5 TRCN0000319793 GATGTCTACCTCTGAGAATAA pLKO_005 763 CDS 100% 13.200 9.240 N Rabepk n/a
6 TRCN0000200381 GCACTGGACTGTACTTCAGTT pLKO.1 682 CDS 100% 4.950 3.465 N Rabepk n/a
7 TRCN0000319792 GCACTGGACTGTACTTCAGTT pLKO_005 682 CDS 100% 4.950 3.465 N Rabepk n/a
8 TRCN0000177212 GCATTGATATAGGTGACATGA pLKO.1 513 CDS 100% 4.950 3.465 N Rabepk n/a
9 TRCN0000319791 GCATTGATATAGGTGACATGA pLKO_005 513 CDS 100% 4.950 3.465 N Rabepk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497988.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.