Transcript: Mouse XM_006498048.4

PREDICTED: Mus musculus polypeptide N-acetylgalactosaminyltransferase 5 (Galnt5), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Galnt5 (241391)
Length:
4944
CDS:
77..2869

Additional Resources:

NCBI RefSeq record:
XM_006498048.4
NBCI Gene record:
Galnt5 (241391)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498048.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413550 CATTGCAGATATGGGTCATTT pLKO_005 898 CDS 100% 13.200 18.480 N Galnt5 n/a
2 TRCN0000413812 ACGTACAGAAACCTTCGATAA pLKO_005 622 CDS 100% 10.800 15.120 N Galnt5 n/a
3 TRCN0000093776 GCGATACATCAAAGCAAGCAT pLKO.1 678 CDS 100% 3.000 2.400 N Galnt5 n/a
4 TRCN0000418972 ATACCTGGGTAAGACTTATTA pLKO_005 2583 CDS 100% 15.000 10.500 N Galnt5 n/a
5 TRCN0000424208 TCAACGCAGGGCTACTCAAAG pLKO_005 195 CDS 100% 10.800 7.560 N Galnt5 n/a
6 TRCN0000093778 CCATTGTGACAACAGAAACAA pLKO.1 2659 CDS 100% 5.625 3.938 N Galnt5 n/a
7 TRCN0000093775 GCCATGCAAATATCCCTGAAA pLKO.1 1275 CDS 100% 4.950 3.465 N Galnt5 n/a
8 TRCN0000093777 GCTATCATTCAAGGTCTGGAT pLKO.1 2149 CDS 100% 2.640 1.848 N Galnt5 n/a
9 TRCN0000093774 GCTGACTGAATTTCTCTCCAT pLKO.1 2926 3UTR 100% 2.640 1.848 N Galnt5 n/a
10 TRCN0000036414 CCTCTCATTCAGTGAGATCAA pLKO.1 178 CDS 100% 0.495 0.347 N GALNT5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498048.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.