Transcript: Mouse XM_006498345.1

PREDICTED: Mus musculus RNA binding motif protein 43 (Rbm43), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rbm43 (71684)
Length:
2138
CDS:
379..1410

Additional Resources:

NCBI RefSeq record:
XM_006498345.1
NBCI Gene record:
Rbm43 (71684)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498345.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200958 CCAAAGGAGTTGCGTATATCA pLKO.1 533 CDS 100% 5.625 7.875 N Rbm43 n/a
2 TRCN0000320294 CCAAAGGAGTTGCGTATATCA pLKO_005 533 CDS 100% 5.625 7.875 N Rbm43 n/a
3 TRCN0000200810 GCACTCAAATTGAGCTAGAAA pLKO.1 695 CDS 100% 5.625 7.875 N Rbm43 n/a
4 TRCN0000320297 GCACTCAAATTGAGCTAGAAA pLKO_005 695 CDS 100% 5.625 7.875 N Rbm43 n/a
5 TRCN0000192169 CCCATCTAAGGTATAGGAGAA pLKO.1 1453 3UTR 100% 4.050 5.670 N Rbm43 n/a
6 TRCN0000320234 CCCATCTAAGGTATAGGAGAA pLKO_005 1453 3UTR 100% 4.050 5.670 N Rbm43 n/a
7 TRCN0000191854 GCGTATATCATCTTCAAGGAA pLKO.1 544 CDS 100% 3.000 4.200 N Rbm43 n/a
8 TRCN0000320296 GCGTATATCATCTTCAAGGAA pLKO_005 544 CDS 100% 3.000 4.200 N Rbm43 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498345.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.