Transcript: Mouse XM_006498536.3

PREDICTED: Mus musculus cadherin 22 (Cdh22), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdh22 (104010)
Length:
1972
CDS:
86..1315

Additional Resources:

NCBI RefSeq record:
XM_006498536.3
NBCI Gene record:
Cdh22 (104010)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498536.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438970 ATTGATCGGGACTCGGATTTG pLKO_005 158 CDS 100% 10.800 15.120 N Cdh22 n/a
2 TRCN0000428639 GCTTTCTGGCATCCAATTAAA pLKO_005 1573 3UTR 100% 15.000 10.500 N Cdh22 n/a
3 TRCN0000094336 GATGAAGACATGCGGGACAAT pLKO.1 842 CDS 100% 4.950 3.465 N Cdh22 n/a
4 TRCN0000437174 GAAGGAAGGGCTGGTCATTTA pLKO_005 1597 3UTR 100% 13.200 7.920 N Cdh22 n/a
5 TRCN0000094338 GTTCTCATCCTGGTTGTTCTT pLKO.1 764 CDS 100% 4.950 2.970 N Cdh22 n/a
6 TRCN0000165205 GCCTCAGTTTCCTCATCTGTA pLKO.1 1823 3UTR 100% 4.950 2.475 Y YIF1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498536.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.