Transcript: Mouse XM_006498569.3

PREDICTED: Mus musculus biliverdin reductase A (Blvra), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Blvra (109778)
Length:
1304
CDS:
200..1213

Additional Resources:

NCBI RefSeq record:
XM_006498569.3
NBCI Gene record:
Blvra (109778)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498569.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042132 GAGGTTGATGTCGCCTATATT pLKO.1 521 CDS 100% 15.000 21.000 N Blvra n/a
2 TRCN0000351453 GAGGTTGATGTCGCCTATATT pLKO_005 521 CDS 100% 15.000 21.000 N Blvra n/a
3 TRCN0000042130 CCAGCCACGAAGACTATATAA pLKO.1 555 CDS 100% 15.000 12.000 N Blvra n/a
4 TRCN0000334752 CCAGCCACGAAGACTATATAA pLKO_005 555 CDS 100% 15.000 12.000 N Blvra n/a
5 TRCN0000042128 GCCAAATGTAGGAGTCAATAA pLKO.1 1045 CDS 100% 13.200 10.560 N Blvra n/a
6 TRCN0000334668 GCCAAATGTAGGAGTCAATAA pLKO_005 1045 CDS 100% 13.200 10.560 N Blvra n/a
7 TRCN0000042131 CATATAAGCATCCACTTCAAA pLKO.1 1004 CDS 100% 5.625 4.500 N Blvra n/a
8 TRCN0000351526 CATATAAGCATCCACTTCAAA pLKO_005 1004 CDS 100% 5.625 4.500 N Blvra n/a
9 TRCN0000042129 CCTTGATAATGTACGGCAGAT pLKO.1 472 CDS 100% 4.050 2.835 N Blvra n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498569.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.