Transcript: Mouse XM_006498604.1

PREDICTED: Mus musculus ATPase, class II, type 9A (Atp9a), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atp9a (11981)
Length:
3622
CDS:
211..3288

Additional Resources:

NCBI RefSeq record:
XM_006498604.1
NBCI Gene record:
Atp9a (11981)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498604.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101652 CTGTCCTACAAGACGTTCTTA pLKO.1 2899 CDS 100% 5.625 7.875 N Atp9a n/a
2 TRCN0000323750 CTGTCCTACAAGACGTTCTTA pLKO_005 2899 CDS 100% 5.625 7.875 N Atp9a n/a
3 TRCN0000101651 CCGATGTTATGTGCGTGACAA pLKO.1 519 CDS 100% 4.950 6.930 N Atp9a n/a
4 TRCN0000353733 CCGATGTTATGTGCGTGACAA pLKO_005 519 CDS 100% 4.950 6.930 N Atp9a n/a
5 TRCN0000101654 CCTGGAGGTTTGCCTCAAATA pLKO.1 2343 CDS 100% 13.200 9.240 N Atp9a n/a
6 TRCN0000353808 CCTGGAGGTTTGCCTCAAATA pLKO_005 2343 CDS 100% 13.200 9.240 N Atp9a n/a
7 TRCN0000101650 TGAGAGCTGTACCTATCAGAA pLKO.1 3472 3UTR 100% 4.950 3.465 N Atp9a n/a
8 TRCN0000323682 TGAGAGCTGTACCTATCAGAA pLKO_005 3472 3UTR 100% 4.950 3.465 N Atp9a n/a
9 TRCN0000101653 GCAGAGTCACATCTTCAGCAT pLKO.1 1407 CDS 100% 2.640 1.848 N Atp9a n/a
10 TRCN0000353807 GCAGAGTCACATCTTCAGCAT pLKO_005 1407 CDS 100% 2.640 1.848 N Atp9a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498604.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.