Transcript: Mouse XM_006498645.2

PREDICTED: Mus musculus CD44 antigen (Cd44), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cd44 (12505)
Length:
5532
CDS:
324..2540

Additional Resources:

NCBI RefSeq record:
XM_006498645.2
NBCI Gene record:
Cd44 (12505)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498645.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262944 GGACCGGTTACCATAACTATT pLKO_005 759 CDS 100% 13.200 18.480 N Cd44 n/a
2 TRCN0000262945 GTGTAGTGCCTACGCCATTAA pLKO_005 2535 CDS 100% 13.200 18.480 N Cd44 n/a
3 TRCN0000065354 CGGAGTCAAATACCAACCCAA pLKO.1 1117 CDS 100% 2.640 3.696 N Cd44 n/a
4 TRCN0000262947 ACAGCAAGAAGGGCGAGTATA pLKO_005 802 CDS 100% 13.200 10.560 N Cd44 n/a
5 TRCN0000065355 CCTCCCACTATGACACATATT pLKO.1 670 CDS 100% 13.200 10.560 N Cd44 n/a
6 TRCN0000065353 CCTTTCAATAACCATGAGTAT pLKO.1 1413 CDS 100% 4.950 3.960 N Cd44 n/a
7 TRCN0000262948 CCAACCACACAGGAGTATATA pLKO_005 631 CDS 100% 15.000 10.500 N Cd44 n/a
8 TRCN0000262946 GATACCTTCATGTCCATATTT pLKO_005 4839 3UTR 100% 15.000 10.500 N Cd44 n/a
9 TRCN0000065357 CCGAATTAGCTGGACACTCAA pLKO.1 2173 CDS 100% 4.950 3.465 N Cd44 n/a
10 TRCN0000065356 CGACCCAATCTCACATCCAAT pLKO.1 1667 CDS 100% 4.950 3.465 N Cd44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498645.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.