Transcript: Mouse XM_006498747.1

PREDICTED: Mus musculus fibrillin 1 (Fbn1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fbn1 (14118)
Length:
9827
CDS:
214..8835

Additional Resources:

NCBI RefSeq record:
XM_006498747.1
NBCI Gene record:
Fbn1 (14118)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498747.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339534 GTGAACACATCTGAGTATAAA pLKO_005 4957 CDS 100% 15.000 21.000 N Fbn1 n/a
2 TRCN0000339535 TGTCTGTGGATCACGTTATAA pLKO_005 384 CDS 100% 15.000 21.000 N Fbn1 n/a
3 TRCN0000109519 GCCAAGAAATCCCGAACATAT pLKO.1 5777 CDS 100% 13.200 18.480 N Fbn1 n/a
4 TRCN0000339536 TGGATTGGAGACGGCATTAAG pLKO_005 4279 CDS 100% 13.200 18.480 N Fbn1 n/a
5 TRCN0000379312 CTGGCTACACTCCGGATATAA pLKO_005 7511 CDS 100% 15.000 12.000 N Fbn1 n/a
6 TRCN0000109516 CGGGATATGAAGTAGACATAA pLKO.1 2474 CDS 100% 13.200 10.560 N Fbn1 n/a
7 TRCN0000377027 ACCTTAGGCAGGTAGAATTAT pLKO_005 8874 3UTR 100% 15.000 10.500 N Fbn1 n/a
8 TRCN0000109517 GCTTCGTGATTGACATTTATA pLKO.1 5480 CDS 100% 15.000 10.500 N Fbn1 n/a
9 TRCN0000379241 AGGCTCTTCTGTGTCGATATT pLKO_005 3793 CDS 100% 13.200 9.240 N Fbn1 n/a
10 TRCN0000109518 CCTGGTGGAAATCAGTGTATT pLKO.1 436 CDS 100% 13.200 9.240 N Fbn1 n/a
11 TRCN0000339464 GCTACCCTGTCATGCGTATTG pLKO_005 9046 3UTR 100% 10.800 7.560 N Fbn1 n/a
12 TRCN0000055893 CCAGACTACATGCAAGTGAAT pLKO.1 5245 CDS 100% 4.950 3.465 N FBN1 n/a
13 TRCN0000055894 CCTGCATTGATAACAATGAAT pLKO.1 7781 CDS 100% 0.563 0.394 N FBN1 n/a
14 TRCN0000286598 CCTGCATTGATAACAATGAAT pLKO_005 7781 CDS 100% 0.563 0.394 N FBN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498747.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.