Transcript: Mouse XM_006498811.2

PREDICTED: Mus musculus integrin beta 6 (Itgb6), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Itgb6 (16420)
Length:
4652
CDS:
96..2459

Additional Resources:

NCBI RefSeq record:
XM_006498811.2
NBCI Gene record:
Itgb6 (16420)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498811.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306106 TATCGGCCAACTCATTGATAA pLKO_005 1028 CDS 100% 13.200 18.480 N Itgb6 n/a
2 TRCN0000306038 TCCTAATAACTACGGATAATG pLKO_005 2137 CDS 100% 13.200 18.480 N Itgb6 n/a
3 TRCN0000067220 CCCGCATAGAAGTCCTTCAAA pLKO.1 334 CDS 100% 5.625 7.875 N Itgb6 n/a
4 TRCN0000067218 CCCTCCTATTATTCCACATTT pLKO.1 3378 3UTR 100% 13.200 10.560 N Itgb6 n/a
5 TRCN0000325686 CCCTCCTATTATTCCACATTT pLKO_005 3378 3UTR 100% 13.200 10.560 N Itgb6 n/a
6 TRCN0000306037 AGAAGATTTCTGCTAATATTG pLKO_005 784 CDS 100% 13.200 9.240 N Itgb6 n/a
7 TRCN0000067219 GCCGAGAGATTCAATGAAATT pLKO.1 753 CDS 100% 13.200 9.240 N Itgb6 n/a
8 TRCN0000325685 GCCGAGAGATTCAATGAAATT pLKO_005 753 CDS 100% 13.200 9.240 N Itgb6 n/a
9 TRCN0000067222 GCCAAAGAGATGTCCAAACTA pLKO.1 573 CDS 100% 5.625 3.938 N Itgb6 n/a
10 TRCN0000067221 CCTGCTCTCTACAAGGAGAAA pLKO.1 2098 CDS 100% 4.950 3.465 N Itgb6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498811.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.