Transcript: Mouse XM_006498884.3

PREDICTED: Mus musculus myelin basic protein expression factor 2, repressor (Myef2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Myef2 (17876)
Length:
7576
CDS:
72..1796

Additional Resources:

NCBI RefSeq record:
XM_006498884.3
NBCI Gene record:
Myef2 (17876)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498884.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337470 TTGGACCGCAATGCGTAATTT pLKO_005 1779 CDS 100% 15.000 21.000 N Myef2 n/a
2 TRCN0000011995 CATGTAATGTTTGCAGAGATA pLKO.1 1635 CDS 100% 4.950 3.465 N Myef2 n/a
3 TRCN0000011994 GCTGAACATAACTGGTGTAAT pLKO.1 1091 CDS 100% 13.200 6.600 Y Myef2 n/a
4 TRCN0000337469 GCTGAACATAACTGGTGTAAT pLKO_005 1091 CDS 100% 13.200 6.600 Y Myef2 n/a
5 TRCN0000011997 GCCAATCGGTTCCATCCTTAT pLKO.1 273 CDS 100% 10.800 5.400 Y Myef2 n/a
6 TRCN0000337467 GCCAATCGGTTCCATCCTTAT pLKO_005 273 CDS 100% 10.800 5.400 Y Myef2 n/a
7 TRCN0000011996 GCAACCAGATATTTGTTAGAA pLKO.1 1558 CDS 100% 5.625 2.813 Y Myef2 n/a
8 TRCN0000011993 GCAGGCTATTAAAGATTTGAT pLKO.1 383 CDS 100% 5.625 2.813 Y Myef2 n/a
9 TRCN0000337468 GCAGGCTATTAAAGATTTGAT pLKO_005 383 CDS 100% 5.625 2.813 Y Myef2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498884.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.