Transcript: Mouse XM_006498928.4

PREDICTED: Mus musculus phospholipase A2 receptor 1 (Pla2r1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Pla2r1 (18779)
Length:
5727
CDS:
92..4279

Additional Resources:

NCBI RefSeq record:
XM_006498928.4
NBCI Gene record:
Pla2r1 (18779)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498928.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076887 CCGGAAGGAATATGGCACTTT pLKO.1 3890 CDS 100% 4.950 6.930 N Pla2r1 n/a
2 TRCN0000076885 CGCCCAAGATTTGACTCACAT pLKO.1 271 CDS 100% 4.950 6.930 N Pla2r1 n/a
3 TRCN0000076886 CCGTGGTAATATGACTTGGTA pLKO.1 3199 CDS 100% 3.000 4.200 N Pla2r1 n/a
4 TRCN0000076884 CGTGGTAATATGACTTGGTAT pLKO.1 3200 CDS 100% 4.950 3.960 N Pla2r1 n/a
5 TRCN0000450177 AGCACAGCCTGCGAGTCATTT pLKO_005 3470 CDS 100% 13.200 9.240 N Pla2r1 n/a
6 TRCN0000440640 GATTGGTTTGAGTAGCAATAA pLKO_005 1135 CDS 100% 13.200 9.240 N Pla2r1 n/a
7 TRCN0000446237 TATATGCAAACGGGATCTAAA pLKO_005 877 CDS 100% 13.200 9.240 N Pla2r1 n/a
8 TRCN0000076883 GCTCTCAACTAATACTTTGAA pLKO.1 4633 3UTR 100% 5.625 3.938 N Pla2r1 n/a
9 TRCN0000439659 ATCATGAGAAATGGGTAAATG pLKO_005 2898 CDS 100% 13.200 7.920 N Pla2r1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498928.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.