Transcript: Mouse XM_006498981.3

PREDICTED: Mus musculus protein tyrosine phosphatase, non-receptor type 1 (Ptpn1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ptpn1 (19246)
Length:
4655
CDS:
829..1908

Additional Resources:

NCBI RefSeq record:
XM_006498981.3
NBCI Gene record:
Ptpn1 (19246)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498981.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226106 TTTGACCACAGTCGGATTAAA pLKO_005 763 5UTR 100% 15.000 21.000 N Ptpn1 n/a
2 TRCN0000029004 CGGATTAAATTGCACCAGGAA pLKO.1 775 5UTR 100% 2.640 3.696 N Ptpn1 n/a
3 TRCN0000226107 GAAGCCCAGAGGAGCTATATT pLKO_005 835 CDS 100% 15.000 10.500 N Ptpn1 n/a
4 TRCN0000226108 CATGGAGAAAGGCTCGTTAAA pLKO_005 948 CDS 100% 13.200 9.240 N Ptpn1 n/a
5 TRCN0000218522 GTATGCCTTAAGTCAACATTT pLKO_005 4370 3UTR 100% 13.200 9.240 N Ptpn1 n/a
6 TRCN0000029007 CTGCCTCTTACTGATGGACAA pLKO.1 1299 CDS 100% 4.050 2.835 N Ptpn1 n/a
7 TRCN0000029008 GTACGACAGTTGGAGTTGGAA pLKO.1 1072 CDS 100% 3.000 2.100 N Ptpn1 n/a
8 TRCN0000029005 CACTGAAGTTAGGAGACGGAT pLKO.1 1707 CDS 100% 2.640 1.848 N Ptpn1 n/a
9 TRCN0000226109 CCGGCTTCTTTCCTCAATTTC pLKO_005 1171 CDS 100% 13.200 7.920 N Ptpn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498981.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.