Transcript: Mouse XM_006499083.3

PREDICTED: Mus musculus cation channel, sperm associated 2 (Catsper2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Catsper2 (212670)
Length:
2397
CDS:
264..1727

Additional Resources:

NCBI RefSeq record:
XM_006499083.3
NBCI Gene record:
Catsper2 (212670)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499083.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069852 GCTATCCGTTCAAAGCTCATT pLKO.1 306 CDS 100% 4.950 6.930 N Catsper2 n/a
2 TRCN0000424850 AGACTCACTCTTCCGATATTT pLKO_005 1613 CDS 100% 15.000 10.500 N CATSPER2 n/a
3 TRCN0000069850 CCGAAGACATAATAGAAACTT pLKO.1 1123 CDS 100% 5.625 3.938 N Catsper2 n/a
4 TRCN0000069849 CCTGAGTTAGTAGTGCTGTTA pLKO.1 828 CDS 100% 4.950 3.465 N Catsper2 n/a
5 TRCN0000069848 GCGCAAGAAGTTACAAGAATT pLKO.1 1670 CDS 100% 0.000 0.000 N Catsper2 n/a
6 TRCN0000129405 GATGATGACGACGACGATGAT pLKO.1 1176 CDS 100% 4.950 2.475 Y C1orf174 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499083.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.