Transcript: Mouse XM_006499172.2

PREDICTED: Mus musculus plakophilin 4 (Pkp4), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pkp4 (227937)
Length:
4435
CDS:
109..3678

Additional Resources:

NCBI RefSeq record:
XM_006499172.2
NBCI Gene record:
Pkp4 (227937)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499172.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123360 GCACCCTTACATACCAAAGAA pLKO.1 1484 CDS 100% 5.625 7.875 N Pkp4 n/a
2 TRCN0000318016 GCACCCTTACATACCAAAGAA pLKO_005 1484 CDS 100% 5.625 7.875 N Pkp4 n/a
3 TRCN0000123362 CCAGCCACCTATGCAGTATTA pLKO.1 3297 CDS 100% 13.200 9.240 N Pkp4 n/a
4 TRCN0000314210 GTGTAGGTGTTAGATCTAATT pLKO_005 3883 3UTR 100% 13.200 9.240 N Pkp4 n/a
5 TRCN0000314153 TAGAGCGAGACCGATTCAAAT pLKO_005 3155 CDS 100% 13.200 9.240 N Pkp4 n/a
6 TRCN0000123363 GCAGAAGTAAGGGAGCTTGTT pLKO.1 1987 CDS 100% 4.950 3.465 N Pkp4 n/a
7 TRCN0000318017 GCAGAAGTAAGGGAGCTTGTT pLKO_005 1987 CDS 100% 4.950 3.465 N Pkp4 n/a
8 TRCN0000123359 GCTTTCCTTCTGACTCTGTTT pLKO.1 3706 3UTR 100% 4.950 3.465 N Pkp4 n/a
9 TRCN0000123361 CGGACTGAAATCAACCACGAA pLKO.1 3579 CDS 100% 2.640 1.848 N Pkp4 n/a
10 TRCN0000318018 CGGACTGAAATCAACCACGAA pLKO_005 3579 CDS 100% 2.640 1.848 N Pkp4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499172.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.