Transcript: Mouse XM_006499266.4

PREDICTED: Mus musculus bromo adjacent homology domain containing 1 (Bahd1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Bahd1 (228536)
Length:
4397
CDS:
99..2441

Additional Resources:

NCBI RefSeq record:
XM_006499266.4
NBCI Gene record:
Bahd1 (228536)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499266.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239098 CTTAATGCAGAGGCCCTTAAT pLKO_005 489 CDS 100% 13.200 18.480 N Bahd1 n/a
2 TRCN0000239096 TCGCTCGGCCAATTGGAATTT pLKO_005 1542 CDS 100% 13.200 18.480 N Bahd1 n/a
3 TRCN0000239099 TGAAGGCTTCACAGGTTAATT pLKO_005 3864 3UTR 100% 15.000 10.500 N Bahd1 n/a
4 TRCN0000425924 ATGAGCCTCCTGTGGTATTAC pLKO_005 2085 CDS 100% 13.200 9.240 N BAHD1 n/a
5 TRCN0000244210 CAAGAGACTGGCTAGCTTAAA pLKO_005 722 CDS 100% 13.200 9.240 N Bahd1 n/a
6 TRCN0000239097 GAAAGACGTCTACACCTTATG pLKO_005 2014 CDS 100% 10.800 7.560 N Bahd1 n/a
7 TRCN0000129912 GCTGGTAGAATTTCAATGGAA pLKO.1 4179 3UTR 100% 3.000 2.100 N BAHD1 n/a
8 TRCN0000130595 CCCACCTGAAATCAAACCAAA pLKO.1 3250 3UTR 100% 4.950 2.970 N BAHD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499266.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.