Transcript: Mouse XM_006499447.3

PREDICTED: Mus musculus RanBP-type and C3HC4-type zinc finger containing 1 (Rbck1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rbck1 (24105)
Length:
2329
CDS:
576..1829

Additional Resources:

NCBI RefSeq record:
XM_006499447.3
NBCI Gene record:
Rbck1 (24105)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499447.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041068 GCACATGAATTGCAGGGAGTA pLKO.1 1517 CDS 100% 4.050 3.240 N Rbck1 n/a
2 TRCN0000316811 GCACATGAATTGCAGGGAGTA pLKO_005 1517 CDS 100% 4.050 3.240 N Rbck1 n/a
3 TRCN0000041070 GCAGACGACAGAGATGCTAAA pLKO.1 1583 CDS 100% 10.800 7.560 N Rbck1 n/a
4 TRCN0000349204 GCAGACGACAGAGATGCTAAA pLKO_005 1583 CDS 100% 10.800 7.560 N Rbck1 n/a
5 TRCN0000041069 CCTACCAGATACCTGCTTCAT pLKO.1 1237 CDS 100% 4.950 3.465 N Rbck1 n/a
6 TRCN0000316812 CCTACCAGATACCTGCTTCAT pLKO_005 1237 CDS 100% 4.950 3.465 N Rbck1 n/a
7 TRCN0000041071 CCTCCCTTAAGGACATGGTAT pLKO.1 820 CDS 100% 4.950 3.465 N Rbck1 n/a
8 TRCN0000041072 GCCGGGTCAATGGGATTCCAT pLKO.1 1780 CDS 100% 1.000 0.700 N Rbck1 n/a
9 TRCN0000316810 GCCGGGTCAATGGGATTCCAT pLKO_005 1780 CDS 100% 1.000 0.700 N Rbck1 n/a
10 TRCN0000338176 TCTTTGAGGATGATGTCAATG pLKO_005 1438 CDS 100% 10.800 7.560 N RBCK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499447.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.