Transcript: Mouse XM_006499492.2

PREDICTED: Mus musculus exonuclease 3'-5' domain containing 1 (Exd1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Exd1 (241624)
Length:
5114
CDS:
120..1553

Additional Resources:

NCBI RefSeq record:
XM_006499492.2
NBCI Gene record:
Exd1 (241624)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499492.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182153 CGAAGCCCATAAGGACTCTAA pLKO.1 1211 CDS 100% 4.950 6.930 N Exd1 n/a
2 TRCN0000176733 CCTACAGGTTAGAAATGTATT pLKO.1 1989 3UTR 100% 13.200 9.240 N Exd1 n/a
3 TRCN0000215521 GATCTTGAATGTGGAACTAAT pLKO.1 27 5UTR 100% 13.200 9.240 N Exd1 n/a
4 TRCN0000215896 CCAAACTGTATCAGTACTTTG pLKO.1 603 CDS 100% 10.800 7.560 N Exd1 n/a
5 TRCN0000198325 GCTGGAATGGAGAAAGTGAAA pLKO.1 114 5UTR 100% 4.950 3.465 N Exd1 n/a
6 TRCN0000178303 GATGAGGTGATGTCAGACTTA pLKO.1 804 CDS 100% 4.950 2.970 N Exd1 n/a
7 TRCN0000181017 GCACATGCCTTTAATCCCAAT pLKO.1 2855 3UTR 100% 4.050 2.025 Y Map6d1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499492.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.