Transcript: Mouse XM_006499593.3

PREDICTED: Mus musculus reticulon 4 receptor-like 2 (Rtn4rl2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rtn4rl2 (269295)
Length:
2041
CDS:
16..1392

Additional Resources:

NCBI RefSeq record:
XM_006499593.3
NBCI Gene record:
Rtn4rl2 (269295)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499593.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249492 GGTCAGCCTACAGTACCTCTA pLKO_005 591 CDS 100% 4.050 5.670 N Rtn4rl2 n/a
2 TRCN0000249493 TGCAGTCACTACACCTGTATC pLKO_005 527 CDS 100% 10.800 8.640 N Rtn4rl2 n/a
3 TRCN0000249495 CCAGTACACAGAGACTCTTCT pLKO_005 308 CDS 100% 4.950 3.465 N Rtn4rl2 n/a
4 TRCN0000060866 CCATCCTCTACCTGTTCAACA pLKO.1 818 CDS 100% 4.950 3.465 N RTN4RL2 n/a
5 TRCN0000249491 TCACCATCCTCTACCTGTTCA pLKO_005 815 CDS 100% 4.950 3.465 N Rtn4rl2 n/a
6 TRCN0000249494 CCATCTACAGGATGACTTGTT pLKO_005 633 CDS 100% 4.950 2.970 N Rtn4rl2 n/a
7 TRCN0000060865 CAACAACCTCTCCACCATCTA pLKO.1 402 CDS 100% 4.950 3.465 N RTN4RL2 n/a
8 TRCN0000455023 TGCTCTGCACCTGCTACTCAT pLKO_005 227 CDS 100% 4.950 3.465 N RTN4RL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499593.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.