Transcript: Mouse XM_006499650.3

PREDICTED: Mus musculus phospholipase A2, group IVF (Pla2g4f), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pla2g4f (271844)
Length:
3287
CDS:
270..2834

Additional Resources:

NCBI RefSeq record:
XM_006499650.3
NBCI Gene record:
Pla2g4f (271844)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499650.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427333 GAGAACAGAGTTCATATTATA pLKO_005 3004 3UTR 100% 15.000 21.000 N Pla2g4f n/a
2 TRCN0000414959 CATATTCACCTCCCGTATTAC pLKO_005 2132 CDS 100% 13.200 18.480 N Pla2g4f n/a
3 TRCN0000028220 GCCAGCATTAATGTCCACAAA pLKO.1 1749 CDS 100% 4.950 6.930 N Pla2g4f n/a
4 TRCN0000028232 GCACACAGATAAGTTGTCCAA pLKO.1 437 CDS 100% 2.640 3.696 N Pla2g4f n/a
5 TRCN0000028241 GCATGGCATTCACATAACTAT pLKO.1 2238 CDS 100% 5.625 4.500 N Pla2g4f n/a
6 TRCN0000028226 CGGAACTCTTTGGCTCTGAAT pLKO.1 1855 CDS 100% 4.950 3.960 N Pla2g4f n/a
7 TRCN0000430950 AGGGAGAGGGAAGACTTTAAA pLKO_005 2895 3UTR 100% 15.000 10.500 N Pla2g4f n/a
8 TRCN0000028264 CCATTCTGTTTGACACGAGTA pLKO.1 646 CDS 100% 4.050 2.835 N Pla2g4f n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499650.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.