Transcript: Mouse XM_006499716.3

PREDICTED: Mus musculus Cobl-like 1 (Cobll1), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cobll1 (319876)
Length:
5107
CDS:
219..3983

Additional Resources:

NCBI RefSeq record:
XM_006499716.3
NBCI Gene record:
Cobll1 (319876)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499716.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176828 CCATTTCCAAACCGTACATTT pLKO.1 1117 CDS 100% 13.200 18.480 N Cobll1 n/a
2 TRCN0000216464 GTCAAGTCACACAATTGATTT pLKO.1 539 CDS 100% 13.200 18.480 N Cobll1 n/a
3 TRCN0000176914 GAGTTACTGTTCCATCGAATA pLKO.1 3895 CDS 100% 10.800 15.120 N Cobll1 n/a
4 TRCN0000216675 CATCCTGTTGTAGGCCATATA pLKO.1 1872 CDS 100% 13.200 10.560 N Cobll1 n/a
5 TRCN0000182344 GCAGAGGCATACGATTGAGAA pLKO.1 2705 CDS 100% 4.950 3.960 N Cobll1 n/a
6 TRCN0000216404 GATACATTGTGGCAGTTATTT pLKO.1 4690 3UTR 100% 15.000 10.500 N Cobll1 n/a
7 TRCN0000197617 CTTCCTCTTGTATTTCCCAAA pLKO.1 3390 CDS 100% 4.050 2.835 N Cobll1 n/a
8 TRCN0000197978 CAACACCATTTCCAAACCGTA pLKO.1 1112 CDS 100% 2.640 1.848 N Cobll1 n/a
9 TRCN0000182665 GCCAGCTTGTACATATGGGAA pLKO.1 2435 CDS 100% 0.000 0.000 N Cobll1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499716.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.