Transcript: Mouse XM_006499720.2

PREDICTED: Mus musculus Cobl-like 1 (Cobll1), transcript variant X14, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cobll1 (319876)
Length:
4832
CDS:
16..3708

Additional Resources:

NCBI RefSeq record:
XM_006499720.2
NBCI Gene record:
Cobll1 (319876)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499720.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176828 CCATTTCCAAACCGTACATTT pLKO.1 842 CDS 100% 13.200 18.480 N Cobll1 n/a
2 TRCN0000216464 GTCAAGTCACACAATTGATTT pLKO.1 264 CDS 100% 13.200 18.480 N Cobll1 n/a
3 TRCN0000176914 GAGTTACTGTTCCATCGAATA pLKO.1 3620 CDS 100% 10.800 15.120 N Cobll1 n/a
4 TRCN0000216675 CATCCTGTTGTAGGCCATATA pLKO.1 1597 CDS 100% 13.200 10.560 N Cobll1 n/a
5 TRCN0000182344 GCAGAGGCATACGATTGAGAA pLKO.1 2430 CDS 100% 4.950 3.960 N Cobll1 n/a
6 TRCN0000216404 GATACATTGTGGCAGTTATTT pLKO.1 4415 3UTR 100% 15.000 10.500 N Cobll1 n/a
7 TRCN0000197617 CTTCCTCTTGTATTTCCCAAA pLKO.1 3115 CDS 100% 4.050 2.835 N Cobll1 n/a
8 TRCN0000197978 CAACACCATTTCCAAACCGTA pLKO.1 837 CDS 100% 2.640 1.848 N Cobll1 n/a
9 TRCN0000182665 GCCAGCTTGTACATATGGGAA pLKO.1 2160 CDS 100% 0.000 0.000 N Cobll1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499720.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.