Transcript: Mouse XM_006499772.3

PREDICTED: Mus musculus phospholipase A2, group IVE (Pla2g4e), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pla2g4e (329502)
Length:
4081
CDS:
165..2660

Additional Resources:

NCBI RefSeq record:
XM_006499772.3
NBCI Gene record:
Pla2g4e (329502)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499772.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097216 CGAGTTATTTGGCTCCGAGTT pLKO.1 1703 CDS 100% 4.050 5.670 N Pla2g4e n/a
2 TRCN0000097214 CCGATTTATCTACGTTCTTAT pLKO.1 3240 3UTR 100% 13.200 9.240 N Pla2g4e n/a
3 TRCN0000097218 CCATGTGAAGTTCCCACTCAA pLKO.1 569 CDS 100% 4.950 3.465 N Pla2g4e n/a
4 TRCN0000097215 CCTGAAACAAACCTGTGAGTA pLKO.1 2261 CDS 100% 4.950 3.465 N Pla2g4e n/a
5 TRCN0000097217 CCATCTCTTGACAGTCCTCTA pLKO.1 515 CDS 100% 4.050 2.835 N Pla2g4e n/a
6 TRCN0000156366 CCCTGAAACAAACCTGTGAGT pLKO.1 2260 CDS 100% 2.640 1.848 N PLA2G4E n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499772.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.