Transcript: Mouse XM_006499922.3

PREDICTED: Mus musculus ubiquinol-cytochrome c reductase complex assembly factor 1 (Uqcc1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Uqcc1 (56046)
Length:
2163
CDS:
290..1018

Additional Resources:

NCBI RefSeq record:
XM_006499922.3
NBCI Gene record:
Uqcc1 (56046)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499922.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200583 CCGGATCATAGTTCATTTCAT pLKO.1 793 CDS 100% 5.625 7.875 N Uqcc1 n/a
2 TRCN0000192391 CGATACATTCAACTCCTGGTT pLKO.1 697 CDS 100% 2.640 3.696 N Uqcc1 n/a
3 TRCN0000328953 CGATACATTCAACTCCTGGTT pLKO_005 697 CDS 100% 2.640 3.696 N Uqcc1 n/a
4 TRCN0000200760 GTTCATTTCATGTGGGAAGAT pLKO.1 803 CDS 100% 4.950 3.465 N Uqcc1 n/a
5 TRCN0000328887 GTTCATTTCATGTGGGAAGAT pLKO_005 803 CDS 100% 4.950 3.465 N Uqcc1 n/a
6 TRCN0000202241 GAAGACTGACTTCGAGGAGTT pLKO.1 655 CDS 100% 4.050 2.835 N Uqcc1 n/a
7 TRCN0000148979 GATGTGTCTAGTCCGAATGAA pLKO.1 742 CDS 100% 5.625 3.375 N UQCC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499922.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.