Transcript: Mouse XM_006499960.2

PREDICTED: Mus musculus solute carrier family 43, member 3 (Slc43a3), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc43a3 (58207)
Length:
2562
CDS:
329..1837

Additional Resources:

NCBI RefSeq record:
XM_006499960.2
NBCI Gene record:
Slc43a3 (58207)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006499960.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068632 CCTGGCATCCTTCATGAATAA pLKO.1 553 CDS 100% 13.200 9.240 N Slc43a3 n/a
2 TRCN0000324109 CCTGGCATCCTTCATGAATAA pLKO_005 553 CDS 100% 13.200 9.240 N Slc43a3 n/a
3 TRCN0000068629 CCTCGTCATTAAGCTGCTTTA pLKO.1 847 CDS 100% 10.800 7.560 N Slc43a3 n/a
4 TRCN0000068630 CCTTAAACAGAAGTATCAGAA pLKO.1 1399 CDS 100% 4.950 3.465 N Slc43a3 n/a
5 TRCN0000324134 CCTTAAACAGAAGTATCAGAA pLKO_005 1399 CDS 100% 4.950 3.465 N Slc43a3 n/a
6 TRCN0000068631 CCTACAGATTGGGAACCTCTT pLKO.1 760 CDS 100% 4.050 2.835 N Slc43a3 n/a
7 TRCN0000324081 CCTACAGATTGGGAACCTCTT pLKO_005 760 CDS 100% 4.050 2.835 N Slc43a3 n/a
8 TRCN0000068628 TCTAGCCTCGATGATGCCTTT pLKO.1 1845 3UTR 100% 4.050 2.835 N Slc43a3 n/a
9 TRCN0000324136 TCTAGCCTCGATGATGCCTTT pLKO_005 1845 3UTR 100% 4.050 2.835 N Slc43a3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006499960.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.