Transcript: Mouse XM_006500096.3

PREDICTED: Mus musculus family with sequence similarity 98, member B (Fam98b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam98b (68215)
Length:
1805
CDS:
55..1263

Additional Resources:

NCBI RefSeq record:
XM_006500096.3
NBCI Gene record:
Fam98b (68215)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500096.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191131 CCAGATAAAGTCCTTATGCAA pLKO.1 225 CDS 100% 3.000 4.200 N Fam98b n/a
2 TRCN0000191847 GATAAAGTCCTTATGCAACCT pLKO.1 228 CDS 100% 2.640 2.112 N Fam98b n/a
3 TRCN0000415287 AGTGTCGCCGACGGATGTTAA pLKO_005 629 CDS 100% 13.200 9.240 N Fam98b n/a
4 TRCN0000428035 AGTACAGAACTTCAAGCTTTA pLKO_005 415 CDS 100% 10.800 7.560 N Fam98b n/a
5 TRCN0000190520 GAGAGCTTCCAGCTTGAGATA pLKO.1 286 CDS 100% 4.950 3.465 N Fam98b n/a
6 TRCN0000190742 GAGAGATGACCTAGAGAGCTT pLKO.1 273 CDS 100% 2.640 1.584 N Fam98b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500096.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.