Transcript: Mouse XM_006500131.1

PREDICTED: Mus musculus DTW domain containing 1 (Dtwd1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dtwd1 (69185)
Length:
1449
CDS:
232..1146

Additional Resources:

NCBI RefSeq record:
XM_006500131.1
NBCI Gene record:
Dtwd1 (69185)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500131.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000181626 GTAACCATGTGTTATGCCCAT pLKO.1 1204 3UTR 100% 2.160 3.024 N Dtwd1 n/a
2 TRCN0000345441 GTAACCATGTGTTATGCCCAT pLKO_005 1204 3UTR 100% 2.160 3.024 N Dtwd1 n/a
3 TRCN0000197851 GCTTCCATTGAAGATTGATAT pLKO.1 495 CDS 100% 13.200 10.560 N Dtwd1 n/a
4 TRCN0000177858 CTTCGGGAGTTATTACAAGTT pLKO.1 892 CDS 100% 4.950 3.465 N Dtwd1 n/a
5 TRCN0000345437 CTTCGGGAGTTATTACAAGTT pLKO_005 892 CDS 100% 4.950 3.465 N Dtwd1 n/a
6 TRCN0000176896 GCCATTTATTACTTCCTAGTA pLKO.1 988 CDS 100% 4.950 3.465 N Dtwd1 n/a
7 TRCN0000345501 GCCATTTATTACTTCCTAGTA pLKO_005 988 CDS 100% 4.950 3.465 N Dtwd1 n/a
8 TRCN0000181843 GTTATGCCCATGAGAGAACAT pLKO.1 1214 3UTR 100% 4.950 3.465 N Dtwd1 n/a
9 TRCN0000345442 GTTATGCCCATGAGAGAACAT pLKO_005 1214 3UTR 100% 4.950 3.465 N Dtwd1 n/a
10 TRCN0000198808 CACAAACCACTTCCATTGCTT pLKO.1 305 CDS 100% 3.000 2.100 N Dtwd1 n/a
11 TRCN0000197873 GAAGCCATTTATTACTTCCTA pLKO.1 985 CDS 100% 3.000 2.100 N Dtwd1 n/a
12 TRCN0000177538 CAGTCTATCTCAATAGAAGAT pLKO.1 664 CDS 100% 0.495 0.347 N Dtwd1 n/a
13 TRCN0000345499 CAGTCTATCTCAATAGAAGAT pLKO_005 664 CDS 100% 0.495 0.347 N Dtwd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500131.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.