Transcript: Mouse XM_006500184.4

PREDICTED: Mus musculus chromodomain helicase DNA binding protein 6 (Chd6), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Chd6 (71389)
Length:
8540
CDS:
118..6225

Additional Resources:

NCBI RefSeq record:
XM_006500184.4
NBCI Gene record:
Chd6 (71389)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500184.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305502 CTCAACCGCACTGACTATTAC pLKO_005 2863 CDS 100% 13.200 18.480 N Chd6 n/a
2 TRCN0000358973 GATACACCTATGAGCGAATTG pLKO_005 554 CDS 100% 10.800 15.120 N CHD6 n/a
3 TRCN0000096741 CCTGGTATTGAGGCAGAAATT pLKO.1 3343 CDS 100% 13.200 10.560 N Chd6 n/a
4 TRCN0000096743 CGTGAAGGTATATCGCCTAAT pLKO.1 789 CDS 100% 10.800 8.640 N Chd6 n/a
5 TRCN0000096742 GCCTCGAAATGAACTCCTAAA pLKO.1 5421 CDS 100% 10.800 8.640 N Chd6 n/a
6 TRCN0000309879 GCCTCGAAATGAACTCCTAAA pLKO_005 5421 CDS 100% 10.800 8.640 N Chd6 n/a
7 TRCN0000096739 CGGCTGTTAAATCCTAAAGAT pLKO.1 7923 3UTR 100% 5.625 4.500 N Chd6 n/a
8 TRCN0000309880 CGGCTGTTAAATCCTAAAGAT pLKO_005 7923 3UTR 100% 5.625 4.500 N Chd6 n/a
9 TRCN0000311332 CAGGCGTCTGGTCACTATTTA pLKO_005 2280 CDS 100% 15.000 10.500 N Chd6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500184.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.