Transcript: Mouse XM_006500188.2

PREDICTED: Mus musculus DEAH (Asp-Glu-Ala-His) box polypeptide 35 (Dhx35), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dhx35 (71715)
Length:
3311
CDS:
104..2215

Additional Resources:

NCBI RefSeq record:
XM_006500188.2
NBCI Gene record:
Dhx35 (71715)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500188.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433636 GCTATGTGCGTTAAGTATAAA pLKO_005 2634 3UTR 100% 15.000 21.000 N Dhx35 n/a
2 TRCN0000113016 CCGTGGTGATTGTTGGAGAAA pLKO.1 318 CDS 100% 4.950 6.930 N Dhx35 n/a
3 TRCN0000113018 CGGGAAAGTGTTATCGCCTTT pLKO.1 1299 CDS 100% 4.050 5.670 N Dhx35 n/a
4 TRCN0000444818 TGATGGTGGATCCGCTGTTAA pLKO_005 585 CDS 100% 13.200 10.560 N Dhx35 n/a
5 TRCN0000113015 CCGTAGCTTGAAAGTTTATTT pLKO.1 3158 3UTR 100% 15.000 10.500 N Dhx35 n/a
6 TRCN0000432072 AGTCCTGTTCCAGATTATATC pLKO_005 857 CDS 100% 13.200 9.240 N Dhx35 n/a
7 TRCN0000413516 CAATGTGTATGAAGCGTTTAT pLKO_005 1750 CDS 100% 13.200 9.240 N Dhx35 n/a
8 TRCN0000432868 AGGCCGAGTAGCTGATGAAAG pLKO_005 454 CDS 100% 10.800 7.560 N Dhx35 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500188.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.