Transcript: Mouse XM_006500219.3

PREDICTED: Mus musculus WD repeat, SAM and U-box domain containing 1 (Wdsub1), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wdsub1 (72137)
Length:
2031
CDS:
164..1591

Additional Resources:

NCBI RefSeq record:
XM_006500219.3
NBCI Gene record:
Wdsub1 (72137)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500219.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251175 TGGAAGACCTCGTCGGTATTT pLKO_005 1197 CDS 100% 13.200 18.480 N Wdsub1 n/a
2 TRCN0000251177 AGTGTCAAGGATAGCTCATTG pLKO_005 569 CDS 100% 10.800 15.120 N Wdsub1 n/a
3 TRCN0000215785 CACAGACATACAAACTATATA pLKO.1 540 CDS 100% 15.000 10.500 N Wdsub1 n/a
4 TRCN0000251174 ACGAGTTCATCTGCCCAATAA pLKO_005 1377 CDS 100% 13.200 9.240 N Wdsub1 n/a
5 TRCN0000251176 ACAGGCATCGGATCCACTTTC pLKO_005 1600 3UTR 100% 10.800 7.560 N Wdsub1 n/a
6 TRCN0000251178 GCAAAGTCCTGAGGAGTATTG pLKO_005 1311 CDS 100% 10.800 7.560 N Wdsub1 n/a
7 TRCN0000200872 GTGGATAAATCTGTCATCATA pLKO.1 935 CDS 100% 5.625 3.938 N Wdsub1 n/a
8 TRCN0000202084 CCAAGATGGATTCCCTCTCTT pLKO.1 1344 CDS 100% 4.950 3.465 N Wdsub1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500219.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.