Transcript: Mouse XM_006500224.3

PREDICTED: Mus musculus WD repeat, SAM and U-box domain containing 1 (Wdsub1), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wdsub1 (72137)
Length:
1308
CDS:
276..1199

Additional Resources:

NCBI RefSeq record:
XM_006500224.3
NBCI Gene record:
Wdsub1 (72137)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500224.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251177 AGTGTCAAGGATAGCTCATTG pLKO_005 681 CDS 100% 10.800 15.120 N Wdsub1 n/a
2 TRCN0000215785 CACAGACATACAAACTATATA pLKO.1 652 CDS 100% 15.000 10.500 N Wdsub1 n/a
3 TRCN0000200872 GTGGATAAATCTGTCATCATA pLKO.1 1047 CDS 100% 5.625 3.938 N Wdsub1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500224.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.