Transcript: Mouse XM_006500238.3

PREDICTED: Mus musculus proline rich 5 like (Prr5l), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prr5l (72446)
Length:
4162
CDS:
250..1362

Additional Resources:

NCBI RefSeq record:
XM_006500238.3
NBCI Gene record:
Prr5l (72446)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500238.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000174406 CAAGTTGCCTTCTTCTGTTAT pLKO.1 792 CDS 100% 13.200 9.240 N Prr5l n/a
2 TRCN0000215609 GTGAACTTGGATCATTCATTA pLKO.1 509 CDS 100% 13.200 9.240 N Prr5l n/a
3 TRCN0000133670 GAAGAGTGAACTTGGATCATT pLKO.1 504 CDS 100% 5.625 3.938 N PRR5L n/a
4 TRCN0000134566 GAGTGAACTTGGATCATTCAT pLKO.1 507 CDS 100% 5.625 3.938 N PRR5L n/a
5 TRCN0000175740 GCAGAGTTACTGGGAAATCAT pLKO.1 1848 3UTR 100% 5.625 3.938 N Prr5l n/a
6 TRCN0000173760 CAAGGTGACTGTCCTGAACTA pLKO.1 987 CDS 100% 4.950 3.465 N Prr5l n/a
7 TRCN0000193649 CAATGAGCTGTATGCACTGAA pLKO.1 462 CDS 100% 4.950 3.465 N Prr5l n/a
8 TRCN0000176062 GACTATTTCCAGAACCAGCTT pLKO.1 532 CDS 100% 2.640 1.848 N Prr5l n/a
9 TRCN0000176036 GCTGTCTACATCATGAGCTTT pLKO.1 1921 3UTR 100% 4.950 2.970 N Prr5l n/a
10 TRCN0000177680 CCATCTGTAATGGGATCTGAT pLKO.1 2891 3UTR 100% 4.950 2.475 Y Etfrf1 n/a
11 TRCN0000182716 CCTGAGTTCAATTCCCAGCAA pLKO.1 2852 3UTR 100% 2.640 1.320 Y BC028528 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500238.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.